View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_134 (Length: 223)
Name: NF1246_low_134
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_134 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 76 - 193
Target Start/End: Original strand, 42955876 - 42955993
Alignment:
| Q |
76 |
gcagagatacaacaatttctcagctcaaagattcactcactttattttctctctttcagtctaaaaaataccatctgatttcatgatttcaacaaaccgt |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
42955876 |
gcagagatacaacaatttctcagctcaaagattcactcactttattttctctcattcagtctaaaaaataccatctgatttcatgttttcaacaagccgt |
42955975 |
T |
|
| Q |
176 |
gacatatataaccgatat |
193 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
42955976 |
gacatatataaccgatat |
42955993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University