View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_137 (Length: 220)
Name: NF1246_low_137
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_137 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 111 - 220
Target Start/End: Original strand, 39793435 - 39793544
Alignment:
| Q |
111 |
ccctgcaacaggtttgtttctactttccacaaaaaggggactgagcacaacaaaagatcccatcatacgaagtggtaggttgccaagaaaaccctacgtt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||| | |
|
|
| T |
39793435 |
ccctgcaacaggtttgtttctactttccacaaaaatgggactgagcacaactaaagataccatcatacgaagtggtaggttgccaagaaaaacctacaat |
39793534 |
T |
 |
| Q |
211 |
taccgccgct |
220 |
Q |
| |
|
|||||||||| |
|
|
| T |
39793535 |
taccgccgct |
39793544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University