View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_151 (Length: 205)
Name: NF1246_low_151
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_151 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 13484226 - 13484352
Alignment:
| Q |
1 |
tgagtgagtgagtgttgattttgttgcttgtttgtcgtctttattcttccctttcattgttagctcgaaagaacttagaccccacaaatgtgttaaaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13484226 |
tgagtgagtgagtgttgattttgttgcttgtttgtcgtctttattcttccctttcattgttagctcgaaagaacttagaccccacaaatgtgttaaaaga |
13484325 |
T |
 |
| Q |
101 |
tttgcattattttatgctactacctct |
127 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
13484326 |
tttgcattattttatgctactatctct |
13484352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University