View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1246_low_151 (Length: 205)

Name: NF1246_low_151
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1246_low_151
NF1246_low_151
[»] chr5 (1 HSPs)
chr5 (1-127)||(13484226-13484352)


Alignment Details
Target: chr5 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 13484226 - 13484352
Alignment:
1 tgagtgagtgagtgttgattttgttgcttgtttgtcgtctttattcttccctttcattgttagctcgaaagaacttagaccccacaaatgtgttaaaaga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13484226 tgagtgagtgagtgttgattttgttgcttgtttgtcgtctttattcttccctttcattgttagctcgaaagaacttagaccccacaaatgtgttaaaaga 13484325  T
101 tttgcattattttatgctactacctct 127  Q
    |||||||||||||||||||||| ||||    
13484326 tttgcattattttatgctactatctct 13484352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University