View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_156 (Length: 201)
Name: NF1246_low_156
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_156 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 12683536 - 12683641
Alignment:
| Q |
1 |
ccaccagcagccggggcggatgtgaccatggaggaagctgagactgagaatgatcagccgcgtcgagatgaagaagaatattatgacgatgatgacggtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12683536 |
ccaccagcagccggggcggatgtgaccatggaggaagctgagactgagaatgatcggccgcatcgagatgaagaagaatattatgacgatgatgacggtg |
12683635 |
T |
|
| Q |
101 |
atgatg |
106 |
Q |
| |
|
|||||| |
|
|
| T |
12683636 |
atgatg |
12683641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University