View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_45 (Length: 381)
Name: NF1246_low_45
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 283
Target Start/End: Original strand, 53805863 - 53806144
Alignment:
| Q |
1 |
ctgagggaatacatgtgtgccacgtgtgcatcggcgagggagtagctttgacggagtgattcgtcgatgaatttgcaacggtcgcggcacaatgacacgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
53805863 |
ctgagggaatacatgtgtgccacgtgtgcatcggcgagggagtagctttgacggagtgattcgtcgatgaatttgaaacggtcgcggcacaatgacacgg |
53805962 |
T |
|
| Q |
101 |
ccggaagccggtcaagtcttgaggcgttgcagcccatcgttatgtttggatgggaaaatgggaaaaaagataacgggtttaaaattatgaatttgtttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53805963 |
ccggaagccggtcaagtcttgaggcgttgcagcccatcgttatgtttggatgtgaaaatgggaaaaaagataacgggtttaaaattatgaatttgtttgt |
53806062 |
T |
|
| Q |
201 |
atcttattgaaaaggaggaatttcattgggatgggctgtggtatgaagtgttgtttattggtcaattttatcaatggtaatga |
283 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53806063 |
a-cttattgaaaaggaggaatttcattgggatgggctgtggtatgaagtgttgtttattggtcaattttatcaatggtaatga |
53806144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University