View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_46 (Length: 380)
Name: NF1246_low_46
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_46 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 114 - 370
Target Start/End: Complemental strand, 46457219 - 46456963
Alignment:
| Q |
114 |
atcagttaagatgttctttttattaaatgannnnnnnnnnnnactcttatcatattaatgaaatttttattacacattgcagcttggtcattctcttcgg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46457219 |
atcagttaagatgttctttttattaaatgattttttttttttactcttatcatattaatgaaatttttattacacattgcagcttggtcattctcttcgg |
46457120 |
T |
|
| Q |
214 |
acatttacagggaatacagctgtgctgtcactagactttcatccaagtaaacatggccttatttgttcttgtgataataaggagataagattttggaata |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46457119 |
acatttacagggaatacagctgtgctgtcactagactttcatccaagtaaacatggccttatttgttcttgtgataataaggagataagattttggaata |
46457020 |
T |
|
| Q |
314 |
ttgcaaatggtagttgtattgggattttcaaggtaagtaatctcaaacagatattat |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46457019 |
ttgcaaatggtagttgtattgggattttcaaggtaagtaatctcaaacagatattat |
46456963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University