View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_48 (Length: 360)
Name: NF1246_low_48
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 277 - 326
Target Start/End: Original strand, 20004551 - 20004603
Alignment:
| Q |
277 |
caacatgcgactgcactgctgtcaac---tctgcaactcgcaagttttcttcg |
326 |
Q |
| |
|
||||| || ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20004551 |
caacacgcaactgcactgctgtcaacaactctgcaactcgcaagttttcttcg |
20004603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University