View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1246_low_49 (Length: 360)

Name: NF1246_low_49
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1246_low_49
NF1246_low_49
[»] chr3 (1 HSPs)
chr3 (277-326)||(20004551-20004603)


Alignment Details
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 277 - 326
Target Start/End: Original strand, 20004551 - 20004603
Alignment:
277 caacatgcgactgcactgctgtcaac---tctgcaactcgcaagttttcttcg 326  Q
    ||||| || |||||||||||||||||   ||||||||||||||||||||||||    
20004551 caacacgcaactgcactgctgtcaacaactctgcaactcgcaagttttcttcg 20004603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University