View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_54 (Length: 352)
Name: NF1246_low_54
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_54 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 77 - 256
Target Start/End: Original strand, 4795672 - 4795851
Alignment:
| Q |
77 |
attattctgtgatgctgctgagatatgttgatgaggttgaaaaaataaagttaccattaatgctgttacaaccaaagaaattaatgatcctttcattgta |
176 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4795672 |
attattctgtgatgctgctgagctatgttgatgaggttgaaaaaataaagttaccattaatgctgttacaaccaaagaaattaatgatcctttcattgta |
4795771 |
T |
|
| Q |
177 |
ctgttggagctaatatcgaactcttgctagtttataagattgtgcagatatttaattgaatatattgtgaagattattat |
256 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
4795772 |
ctgttggagcaaatatcgaactcttgctagtttataagattgtgcagatgtttaattgaatatagtgtgaagattattat |
4795851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 81 - 118
Target Start/End: Original strand, 4679793 - 4679830
Alignment:
| Q |
81 |
ttctgtgatgctgctgagatatgttgatgaggttgaaa |
118 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
4679793 |
ttctgtggtgctgctgagatatgttgatgtggttgaaa |
4679830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University