View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_56 (Length: 343)
Name: NF1246_low_56
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_56 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 98 - 343
Target Start/End: Complemental strand, 3451783 - 3451538
Alignment:
| Q |
98 |
tatttcctatggtagtgtttgaaattgctttgttttattgcagattagtgttgttgttctgcttcagcttggtactgctgttttacttaaggatgcaggg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3451783 |
tatttcctatggtagtgtttgaaattgctttgttttattgcagattagtgttgttgttctgcttcagcttggtactgctgttttacttaaggatgcaggg |
3451684 |
T |
|
| Q |
198 |
tggctgaagatacttctagtagcctannnnnnnggctcattcctcaaccacaacctcttcttggctatccatgagctcagtcacaatcttgctttttcaa |
297 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3451683 |
cggctgaagatacttctagtagcctatttttttggctcattcctcaaccacaacctcttcttggctatccatgagctcagtcacaatcttgctttttcaa |
3451584 |
T |
|
| Q |
298 |
ctccagtttacaaccgttggcttgggattttcgctaatctccctat |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3451583 |
ctccagtttacaaccgttggcttgggattttcgctaatctccctat |
3451538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University