View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1246_low_57 (Length: 343)

Name: NF1246_low_57
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1246_low_57
NF1246_low_57
[»] chr4 (2 HSPs)
chr4 (151-247)||(36804081-36804177)
chr4 (13-52)||(36804714-36804753)


Alignment Details
Target: chr4 (Bit Score: 81; Significance: 4e-38; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 151 - 247
Target Start/End: Complemental strand, 36804177 - 36804081
Alignment:
151 atataatctaactttttaaacggagctttgatacttgaaagggatgttaactcatcttctgtaacttcaattatggggttgtacattcgttgcaact 247  Q
    ||||||| ||||||||||||  |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36804177 atataatttaactttttaaatagagctttgatacttgagagggatgttaactcatcttctgtaacttcaattatggggttgtacattcgttgcaact 36804081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 13 - 52
Target Start/End: Complemental strand, 36804753 - 36804714
Alignment:
13 aatattaacattgatttctctcttgggagccgtcgtcgtc 52  Q
    ||||||||||||||||||||| ||||||||||||| ||||    
36804753 aatattaacattgatttctcttttgggagccgtcgccgtc 36804714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University