View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_66 (Length: 327)
Name: NF1246_low_66
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_66 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 101 - 251
Target Start/End: Complemental strand, 3874157 - 3874007
Alignment:
| Q |
101 |
actttatggttaccaatgttgctttttgtattggttttagtcatatctttatcagnnnnnnnggataagagcttcacaaggtttgatcgtaattggattc |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3874157 |
actttatggttaccaatgttactttttgtattggttttagtcatatctttatcagcttttttggataagagcttcacaaggtttgatcgtaattggattc |
3874058 |
T |
|
| Q |
201 |
atagagttggtggttcttctggtggtattgttttcattcttattcttctct |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3874057 |
atagagttggtggttcttctggtggtattgttttcattcttattcttctct |
3874007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 101 - 251
Target Start/End: Complemental strand, 3884685 - 3884536
Alignment:
| Q |
101 |
actttatggttaccaatgttgctttttgtattggttttagtcatatctttatcagnnnnnnnggataagagcttcacaaggtttgatcgtaattggattc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3884685 |
actttatggttaccaatgttgctttttgtattggttttagtcatatctttatcagcttttttagataagagcttcacaaggtttgatcgtaattggattc |
3884586 |
T |
|
| Q |
201 |
atagagttggtggttcttctggtggtattgttttcattcttattcttctct |
251 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3884585 |
atagagttggt-gttcttctggtggtattgttttcattcttattcttctct |
3884536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University