View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_69 (Length: 326)
Name: NF1246_low_69
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_69 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 66; Significance: 4e-29; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 182 - 247
Target Start/End: Complemental strand, 8880470 - 8880405
Alignment:
| Q |
182 |
ttgttagacaatgatttgtgtttggaagggaattctcatattctgcttattattaatgttaacttt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8880470 |
ttgttagacaatgatttgtgtttggaagggaattctcatattctgcttattattaatgttaacttt |
8880405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 182 - 246
Target Start/End: Complemental strand, 45073611 - 45073546
Alignment:
| Q |
182 |
ttgttagacaatgatttgtgtttggaagggaa-ttctcatattctgcttattattaatgttaactt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||| |||||||||||||| | |||||||| |
|
|
| T |
45073611 |
ttgttagacaatgatttgtgtttggaagggaacttatcatgttctgcttattattgacgttaactt |
45073546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University