View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_74 (Length: 324)
Name: NF1246_low_74
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_74 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 4e-72; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 70 - 215
Target Start/End: Complemental strand, 45181845 - 45181700
Alignment:
| Q |
70 |
agtactctaatagtaatacacaaccatgttgatctgtttcattaaacaattatgttttgccttttaagattttcagatggaacctacaaattataatcag |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45181845 |
agtactctaatagtaatacacaaccatgttgatctgtttcattaaacaattatgttttgccttttaagattttcagatggaacgtacaaattataatcag |
45181746 |
T |
|
| Q |
170 |
taattacctctatcaacgtatgcttacttaatttacctacttttac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45181745 |
taattacctctatcaacgtatgcttacttgatttacctacttttac |
45181700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 106 - 293
Target Start/End: Complemental strand, 45174927 - 45174745
Alignment:
| Q |
106 |
tttcattaaacaattatgttttgcctttt-aagattttcagatggaacctacaaattataatcagtaattacctctatcaac-gtatgcttacttaattt |
203 |
Q |
| |
|
|||||| || |||||||||||| |||||| ||||||||||| ||||||||||||||| |||| || ||||||| | ||| | |||| ||||||||| |
|
|
| T |
45174927 |
tttcatcaatcaattatgtttttcctttttaagattttcagttggaacctacaaattgcaatc--tagctacctctctaaaccgcttgctgacttaattt |
45174830 |
T |
|
| Q |
204 |
acctacttttacaaaggactatattatattgcaactaggtggtaccgtgcacctgaactatgtggttcttttttcacaaaagtaagtttt |
293 |
Q |
| |
|
|||||||||||| ||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45174829 |
acctacttttaccaaggactatgtt-----gcaactaggtggtaccgtgcacctgaactatgtggttcttttttctcaaaagtaagtttt |
45174745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 246 - 317
Target Start/End: Complemental strand, 45181702 - 45181631
Alignment:
| Q |
246 |
taccgtgcacctgaactatgtggttcttttttcacaaaagtaagttttttgtttgacatcatattttcttgg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45181702 |
taccgtgcacctgaactatgtggttcttttttcacaaaagtaagttttttgtttgacatcatattttcttgg |
45181631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 232 - 289
Target Start/End: Complemental strand, 29962023 - 29961966
Alignment:
| Q |
232 |
ttgcaactaggtggtaccgtgcacctgaactatgtggttcttttttcacaaaagtaag |
289 |
Q |
| |
|
|||| ||| ||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29962023 |
ttgcgactcggtggtatcgtgcacctgaactatgtggttcttttttctcaaaagtaag |
29961966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University