View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1246_low_77 (Length: 320)

Name: NF1246_low_77
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1246_low_77
NF1246_low_77
[»] chr7 (1 HSPs)
chr7 (6-44)||(30168411-30168449)
[»] chr5 (1 HSPs)
chr5 (73-117)||(43245384-43245428)


Alignment Details
Target: chr7 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 6 - 44
Target Start/End: Complemental strand, 30168449 - 30168411
Alignment:
6 agagagaagaaaaagacacgtaggacttccaaaattggg 44  Q
    |||||||||||||||||||||||||||||||||||||||    
30168449 agagagaagaaaaagacacgtaggacttccaaaattggg 30168411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 73 - 117
Target Start/End: Complemental strand, 43245428 - 43245384
Alignment:
73 tgcatttcttgcttgtttcatttgtaaatttcagcatttcccttt 117  Q
    ||||||||||||||||| |||| |||||||||||||||| |||||    
43245428 tgcatttcttgcttgttacattcgtaaatttcagcattttccttt 43245384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University