View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1246_low_83 (Length: 314)

Name: NF1246_low_83
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1246_low_83
NF1246_low_83
[»] chr8 (1 HSPs)
chr8 (104-235)||(38087450-38087581)


Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 104 - 235
Target Start/End: Complemental strand, 38087581 - 38087450
Alignment:
104 gttagagcttttgatagagttgtcattgatgtgcattactacaacttattttctgatcagttctcaaacatgaatgtgaagcagaacattgattatatta 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38087581 gttagagcttttgatagagttgtcattgatgtgcattactacaacttattttctgatcagttctcaaacatgaatgtgaagcagaacattgattatatta 38087482  T
204 aatatcatagagcttctgaccttagatctctg 235  Q
    ||||||||||||||||||||||||||||||||    
38087481 aatatcatagagcttctgaccttagatctctg 38087450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University