View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_86 (Length: 310)
Name: NF1246_low_86
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_86 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 7e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 60 - 218
Target Start/End: Complemental strand, 524941 - 524783
Alignment:
| Q |
60 |
aataaaattctcgagaggaaaaatatgaaatctgtctcaaaatccatctttaagtttagttatatatatttatttcttctaacagtgttatatatgatat |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
524941 |
aataaaattctcgagaggaaaaatatgaaatctgtctcaaaatccatctttaagtttagttatatatatttatttcttctaatagtgttatatatgatat |
524842 |
T |
|
| Q |
160 |
gatatacatctatgcatcatagagttcaagaatgatttgaaaatctatactatactact |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
524841 |
gatatacatctatgcatcatagagttcaagcatgatttgaaaatctatactatactact |
524783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University