View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_88 (Length: 304)
Name: NF1246_low_88
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_88 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 12 - 276
Target Start/End: Complemental strand, 37529844 - 37529576
Alignment:
| Q |
12 |
ataggtccatttgcaaatcggagattgtgttaatatgtagtcctacaagtacttattgttaatgcaaaacttatgcctatttctatagtgtatagaaatc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37529844 |
ataggtccatttgcaaatcggagattgtgttaatatgtagtcctacaagtacttattgttaatgcaaaacttatgcctatttctatagtgtatagaaatc |
37529745 |
T |
 |
| Q |
112 |
aaaact----atttttatttttaaagttgtgttgttgcagagcaacttctagatactcaaaattcagcattggtcgttgcaatttctggaaaagttgcat |
207 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37529744 |
aaaactttttatttttatttttaaagttgtgttgttgcagagcaactactagatactcaaaattcagcattggtcgttgcaatttctggaaaagttgcat |
37529645 |
T |
 |
| Q |
208 |
ctgaaagcacaattgaatgtgaattaagtggtttaaagggtgtaattgtggaagaagcggtacatatgt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37529644 |
ctgaaagcacaattgaatgtgaattaagtggtttaaagggtgtaattgtggaagaagcggtacatatgt |
37529576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University