View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_89 (Length: 298)
Name: NF1246_low_89
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_89 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 67 - 275
Target Start/End: Original strand, 6155868 - 6156076
Alignment:
| Q |
67 |
aactgtccttgcaaaagagggtcaaccatatgttcatactttctccggccattaaaatatgggcgagactgaaatcgaaaaacataagtgtaagatacag |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6155868 |
aactgtccttgcaaaagagggtcaaccatatgttcatactttctccggccattaaaatatgggcgagactgaaatcgaaaaacataagtgtaagatacag |
6155967 |
T |
 |
| Q |
167 |
tcatgtcatatagatagatcaaagacatgatagcatgtcaatgcttttgtaatgaaagatgttttactctcaatagttttttacactcttcaaaacagta |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6155968 |
tcatgtcatatagatagatcaaagacatgatagcatgtcaatgcttttgtaatgaaagatgttttactctcaatagttttttacactcttcaaaacagta |
6156067 |
T |
 |
| Q |
267 |
tagaataat |
275 |
Q |
| |
|
||||||||| |
|
|
| T |
6156068 |
tagaataat |
6156076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 70 - 137
Target Start/End: Original strand, 54031257 - 54031324
Alignment:
| Q |
70 |
tgtccttgcaaaagagggtcaaccatatgttcatactttctccggccattaaaatatgggcgagactg |
137 |
Q |
| |
|
||||||||||||||||| ||| |||||||| || ||||||||||| || | ||||||||||||||||| |
|
|
| T |
54031257 |
tgtccttgcaaaagaggatcagccatatgtacaaactttctccggtcactgaaatatgggcgagactg |
54031324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University