View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_93 (Length: 289)
Name: NF1246_low_93
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_93 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 50 - 279
Target Start/End: Original strand, 6321867 - 6322096
Alignment:
| Q |
50 |
atattttaccaccatgttttgataagcttctagctggcttgttattgcgtccctctaagcgcccttggaagtccgatatgaatttgtacagttatagcaa |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6321867 |
atattttaccaccatgttttgataagcttctagctggcttgttattgcgtccctctaagcgcccttggaagtccgatatgaatttgtacagttatagcaa |
6321966 |
T |
|
| Q |
150 |
taatgctgctgccccagcagcatttgatcagctcagaaaatatcctatgccgtctccttcgtctcctccatgggaggatattaatgaaccacatagctac |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6321967 |
taatgctgctgccccagcagcatttgatcagctcagaaaatatcctatgccatctccttcgtctcctccatgggaggatattaatgaaccacatagctac |
6322066 |
T |
|
| Q |
250 |
aatcagtttaatgaatatgataaccctatg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6322067 |
aatcagtttaatgaatatgataaccctatg |
6322096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University