View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_95 (Length: 286)
Name: NF1246_low_95
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_95 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 44 - 158
Target Start/End: Original strand, 9684054 - 9684168
Alignment:
| Q |
44 |
agtataataattagatctaatgcttgatgttgcttattgattcaaattcacgttaccataaggatgaatacaaagataaattatgtaaaaggcacaaacg |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
9684054 |
agtataataattagatctaatgcttgatgttgcttattgattcaaattcacgttaccataaggatgaatacaaaaataaatgatgtaaaaggcacaaacg |
9684153 |
T |
|
| Q |
144 |
aattattaatattga |
158 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
9684154 |
aattattaatattga |
9684168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University