View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_97 (Length: 286)
Name: NF1246_low_97
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_97 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 7e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 72 - 214
Target Start/End: Complemental strand, 52290809 - 52290670
Alignment:
| Q |
72 |
ataaagagacaattattattatacggagagagtatgtaactggtccaccaaattcacggtcatttggaatagagcctcttgaattgaatgaccccttctt |
171 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| || ||||||||||||||||||| |||||||||||||||||||||||||||| ||| |
|
|
| T |
52290809 |
ataaagagacaattattattatacggagggagtatgtaactgatcaaccaaattcacggtcatttcgaatagagcctcttgaattgaatgaccc---ctt |
52290713 |
T |
|
| Q |
172 |
cagatacgaatcacacattcactcactcggattcagtcattct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52290712 |
gagatacgaatcacacattcactcactcggattcagtcattct |
52290670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University