View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_98 (Length: 285)
Name: NF1246_low_98
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_98 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 64 - 199
Target Start/End: Complemental strand, 44475908 - 44475773
Alignment:
| Q |
64 |
aagtcagtgttaagtatttatatgagatcaccctttctcattgtcctgatctctgcataggaaaaatgaacatgagattagatgtcataaacacatagta |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44475908 |
aagtcagtgttaagtatttatatgagatcaccctttctcattgtcctgatctctgcataggaaaaatgaacatgagattagatgtcataaacacatagta |
44475809 |
T |
 |
| Q |
164 |
catgtgatgcacaaattcataaaatatatacatgta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
44475808 |
catgtgatgcacaaattcataaaatatatacatgta |
44475773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 69 - 130
Target Start/End: Original strand, 38452328 - 38452390
Alignment:
| Q |
69 |
agtgttaagtatttatatg-agatcaccctttctcattgtcctgatctctgcataggaaaaat |
130 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||| || | | ||||||||||||||||| |
|
|
| T |
38452328 |
agtgttaagcatttatatggagatcaccctttctcatcatcataacctctgcataggaaaaat |
38452390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University