View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1246_low_99 (Length: 281)
Name: NF1246_low_99
Description: NF1246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1246_low_99 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 57; Significance: 7e-24; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 126 - 186
Target Start/End: Complemental strand, 11330871 - 11330811
Alignment:
| Q |
126 |
atgatgcctgaaaacaagtagaagagctagcaatatttacttactatcaattgtcttcatc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11330871 |
atgatgcctgaaaacaagtagaagagctagcaatatttacttactatcaattgtctccatc |
11330811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 126 - 181
Target Start/End: Original strand, 7178030 - 7178085
Alignment:
| Q |
126 |
atgatgcctgaaaacaagtagaagagctagcaatatttacttactatcaattgtct |
181 |
Q |
| |
|
||||||||| || |||||| ||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
7178030 |
atgatgcctaaatacaagtggaaaagctaacaatatttacttactatcaattgtct |
7178085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University