View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12470_low_9 (Length: 331)
Name: NF12470_low_9
Description: NF12470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12470_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 56 - 323
Target Start/End: Complemental strand, 38096967 - 38096708
Alignment:
| Q |
56 |
gaccagaccagaccagatcaccatcatttcctactctctttggatgatttcataagcggtatgcatttctctttcactnnnnnnnnttttgcctccctct |
155 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38096967 |
gaccagaccataccagatcaccatcatttcctactctctttggatgatttcataagcggtatgcatttctctttcactccccc---ttttgcctccctct |
38096871 |
T |
|
| Q |
156 |
tttcctcttttgtttcctttaacttcacctcatccatccctagcctgcttctcctgtaagaaaacaaaaggtaacaaattaaacaacaaataaaagaaat |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
38096870 |
tttcctcttttgtttcctttaacttcacctcatccatccctagcctgcttctcctgtaagaaaacaaaaggtaac-atttaaacaacaaataaaagaaat |
38096772 |
T |
|
| Q |
256 |
tctataagtaattaatgagaaacgtacctttcttcattataggaattagatttcttgagcacaggttc |
323 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096771 |
tctaaaag----taatgagaaacgtacctttcttcattataggaattagatttcttgagcacaggttc |
38096708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University