View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12471_high_6 (Length: 345)
Name: NF12471_high_6
Description: NF12471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12471_high_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 93 - 329
Target Start/End: Original strand, 23118241 - 23118477
Alignment:
| Q |
93 |
gctgcagcaagcagattttctttttctcttctccctctttgtcatcgcaaaaaggagagggagcctacatagagggtgcagttggagaggaagcatcaga |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23118241 |
gctgcagcaagcagattttctttttctcttctccctctttgtcatcgcaaaaaggagagggagcctacatagagggtgcagttggagaggaagcatcaga |
23118340 |
T |
|
| Q |
193 |
agaagatgagacatcaggcggattcatgttaaaaaccgaaggctggagaggatttgcggccagaggaggcatgttgagaaggatgttaagcgcgcttgct |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23118341 |
agaagatgagacatcaggcggattcatgttaaaaaccgaaggctggagaggatttgcggccagaggaggcatgttgagaaggatgttaagcgcgcttgct |
23118440 |
T |
|
| Q |
293 |
tgccagttcctctgaatttgtaattcaagagtattgt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23118441 |
tgccagttcctctgaatttgtaattcaagagtattgt |
23118477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 23118149 - 23118204
Alignment:
| Q |
1 |
caagacataaaaataccgaagcttactcagagcaattttgaacagaacataacaac |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23118149 |
caagacataaaaataccgaagcttactcagagcaattttgaacagaacataacaac |
23118204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University