View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12472_low_5 (Length: 242)
Name: NF12472_low_5
Description: NF12472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12472_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 34065627 - 34065412
Alignment:
| Q |
1 |
taatctaagttccagacaagaacaaatggtttggctaattgattttcaagggtggagcacatcgtgcatatcagtaaaggtcacccgagatgctgctcaa |
100 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34065627 |
taatttaagttccacacaagaacaaatggtttggctaattgattttcaagggtggagcacatcgtgcatatcagtaaaggtcacccgagatgctgctcaa |
34065528 |
T |
 |
| Q |
101 |
gtcttgcagaatcattaccctgaaaggttgggccttgcagtcttctacaatccgccaaaattgtttgagtcattttggacggtacgatatcataatatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34065527 |
gtcttgcagaatcattaccctgaaaggttgggccttgcagtcttctacaatccgccaaaattgtttgagtcattttggacggtacgatatcataatctat |
34065428 |
T |
 |
| Q |
201 |
cccctctttataacca |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34065427 |
cccctctttataacca |
34065412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University