View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12477_high_5 (Length: 236)
Name: NF12477_high_5
Description: NF12477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12477_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 112 - 218
Target Start/End: Complemental strand, 5689012 - 5688906
Alignment:
| Q |
112 |
taggtaggttggttcggattgaactaggtcttaaatagactcagctaaaatttcattgagtttatttgtgtcattaggcttgacaggtcacacataaacc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5689012 |
taggtaggttggttcggattgaactaggtcttaaatagactcagctaaaatttcattgagtttatttgtgtcattaggcttgacaggtcacacataaacc |
5688913 |
T |
 |
| Q |
212 |
cgagaac |
218 |
Q |
| |
|
||||||| |
|
|
| T |
5688912 |
cgagaac |
5688906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 5689158 - 5689049
Alignment:
| Q |
1 |
tcaaaaatggtataccgtttaaatcaatattataaaagtctaaaactatactaatagacatnnnnnnnntgtcacaatttacaaacaaattggatttttg |
100 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5689158 |
tcaaaaattgtataccttttaaatcaatattataaaagtctaaaactatattaatagacataaaaaaaatgtcacaatttacaaacaaattggatttttg |
5689059 |
T |
 |
| Q |
101 |
gaattggaaa |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
5689058 |
gaattggaaa |
5689049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University