View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12479_high_12 (Length: 265)
Name: NF12479_high_12
Description: NF12479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12479_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 15 - 247
Target Start/End: Complemental strand, 40954213 - 40953981
Alignment:
| Q |
15 |
gtgaggttgagttgcttgttggattgaatacttcgagggatcctcgagggtccctcggaaatgatggtctttgtgatgaagttgatggtgatttcttcaa |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40954213 |
gtgaggttgagttgcttgttggattgaatacttcgagggatcctcgagggtccctcggaaatgatggtctttgtgatgaagatgatggtgatttcttcaa |
40954114 |
T |
 |
| Q |
115 |
acgctccattgtaactagtaactaccttcctgtagtttccacaatgctgtatatataggaattaatattgttacagnnnnnnnggtttaatacattggac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40954113 |
acgctccattgtaactagtaactaccttcctgtagtttccacaatgctgtatatataggaattaatattgttacagtttttttggtttaatacattggac |
40954014 |
T |
 |
| Q |
215 |
cagttggaccaacattttatgttatgttacatc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40954013 |
cagttggaccaacattttatgttatgttacatc |
40953981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University