View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12479_high_9 (Length: 316)
Name: NF12479_high_9
Description: NF12479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12479_high_9 |
 |  |
|
| [»] scaffold0236 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0236 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: scaffold0236
Description:
Target: scaffold0236; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 23 - 300
Target Start/End: Original strand, 20622 - 20899
Alignment:
| Q |
23 |
taacaacaaaaacacgcactttcatgcattcttctccctctatttataacaacacttttagttcacttcttcacatcaccttcaagtaacaacagtatca |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
20622 |
taacaacaaaaacacgcactttcatgcattcttctccctctatttataacaacacttttagttcatttcttcacatcaccttcaagtaacaacagtatca |
20721 |
T |
 |
| Q |
123 |
catccatggcatccttcattgcaaaatccatatccatcatttctgacaccgtttcttcactcacttccgatgtgaaggccattttcttcactctctgcac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20722 |
catccatggcatccttcattgcaaaatccatatccatcatgtctgacaccgtttcttcactcacttccgatgtgaaggccattttcttcactctctgcac |
20821 |
T |
 |
| Q |
223 |
catgttcctttgccttttcattggcattacaaaccttgcttttcttagcctatttataaccccccttaaactcaacac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20822 |
catgttcctttgccttttcattggcattacaaaccttgcttttcttagcctatttataaccccccttaaactcaacac |
20899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University