View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12479_low_15 (Length: 263)
Name: NF12479_low_15
Description: NF12479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12479_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 42 - 244
Target Start/End: Original strand, 31686993 - 31687197
Alignment:
| Q |
42 |
tttcttgttttgaaaaaacgaaaatgatttatcctgtgtactccaaagagtgaagtgggtcctatgacagtgatgttttaacgtgtttttcagcttttgt |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31686993 |
tttcttgttttgaaaaaacgaaaatgatttatcctatgtactccaaagagtgaagtgggtcctatgacagtgatgttttaacgtgtttttcagcttttgt |
31687092 |
T |
 |
| Q |
142 |
aac-nnnnnnnntaaaacgtgctttttagcttctatcatggagtc-aaaaaacgacactaattagttactataaaaacaaaacagtgatgtagtaatgaa |
239 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31687093 |
aacaaaaaaaaataaaacgtgctttttagcttctatcatggagtcaaaaaaacgacactgattagttactataaaaacaaaacagtgatgtagtaatgaa |
31687192 |
T |
 |
| Q |
240 |
aatca |
244 |
Q |
| |
|
||||| |
|
|
| T |
31687193 |
aatca |
31687197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 44
Target Start/End: Original strand, 31686224 - 31686254
Alignment:
| Q |
14 |
tgtgatcttctgccgggggatgggagatttt |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31686224 |
tgtgatcttctgccgggggatgggagatttt |
31686254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University