View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12479_low_15 (Length: 263)

Name: NF12479_low_15
Description: NF12479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12479_low_15
NF12479_low_15
[»] chr2 (2 HSPs)
chr2 (42-244)||(31686993-31687197)
chr2 (14-44)||(31686224-31686254)


Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 42 - 244
Target Start/End: Original strand, 31686993 - 31687197
Alignment:
42 tttcttgttttgaaaaaacgaaaatgatttatcctgtgtactccaaagagtgaagtgggtcctatgacagtgatgttttaacgtgtttttcagcttttgt 141  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31686993 tttcttgttttgaaaaaacgaaaatgatttatcctatgtactccaaagagtgaagtgggtcctatgacagtgatgttttaacgtgtttttcagcttttgt 31687092  T
142 aac-nnnnnnnntaaaacgtgctttttagcttctatcatggagtc-aaaaaacgacactaattagttactataaaaacaaaacagtgatgtagtaatgaa 239  Q
    |||         ||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
31687093 aacaaaaaaaaataaaacgtgctttttagcttctatcatggagtcaaaaaaacgacactgattagttactataaaaacaaaacagtgatgtagtaatgaa 31687192  T
240 aatca 244  Q
    |||||    
31687193 aatca 31687197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 44
Target Start/End: Original strand, 31686224 - 31686254
Alignment:
14 tgtgatcttctgccgggggatgggagatttt 44  Q
    |||||||||||||||||||||||||||||||    
31686224 tgtgatcttctgccgggggatgggagatttt 31686254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University