View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12479_low_17 (Length: 237)

Name: NF12479_low_17
Description: NF12479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12479_low_17
NF12479_low_17
[»] chr5 (1 HSPs)
chr5 (17-237)||(31668477-31668697)


Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 17 - 237
Target Start/End: Complemental strand, 31668697 - 31668477
Alignment:
17 agtagtcagctttcatatggtggagatgaattattggaagctgaagaatttctgcaaatcttcaagaatacttttgtcccttggtgtctgcagccaaata 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31668697 agtagtcagctttcatatggtggagatgaattattggaagctgaagaatttctgcaaatcttcaagaatacttttgtcccttggtgtctgcagccaaata 31668598  T
117 gttcctcaactaatgctcgtttagatctgttgttgaccttgctggatgataggcatttctcagaacaatggtctttcattgtcaattgtgtgattaacca 216  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||    
31668597 gttcctcaactaatgctcgtttagatcttttgttgaccttgctggatgataggcatttctcagaacaatggtctttcatcgtcaattgtgtaattaacca 31668498  T
217 aagtaattctggatgcccagc 237  Q
    |||||||||||||||||||||    
31668497 aagtaattctggatgcccagc 31668477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University