View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12479_low_6 (Length: 416)
Name: NF12479_low_6
Description: NF12479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12479_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 383; Significance: 0; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 383; E-Value: 0
Query Start/End: Original strand, 17 - 407
Target Start/End: Original strand, 14612217 - 14612607
Alignment:
| Q |
17 |
aaatgtgattgccattggggttgcgttttctagaacaatttatagtgcagttccacaatggagtaagtttataggaggagcattctttagtttttgggtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14612217 |
aaatgtgattgccattggggttgcgttttctagaacaatttatagtgcagttccacaatggagtaagtttataggaggagcattctttagtttttgggtt |
14612316 |
T |
 |
| Q |
117 |
cttgcacatttgtatccatttgcaaaaggattgatgggaaggagagggaagacacccaccattgtatatgtgtggtcaggtctcattgcaattacacttt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14612317 |
cttgcacatttgtatccatttgcaaaaggattgatgggaaggagagggaagacacccaccattgtatatgtgtggtcaggtctcattgcaattacacttt |
14612416 |
T |
 |
| Q |
217 |
ctttgctttggattgccattagcccggccgagggtggtactgaaaaaagtgctagcggaaatttccaatttccatgaaatgataatgcttgcttatgcgt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14612417 |
ctttgctttggattgccattagcccggccgagggtggtactgaaaaaagtgctagcggaaatttccaatttccatgaaatgataatgcttgcttatgcgt |
14612516 |
T |
 |
| Q |
317 |
tgatgcattggttatttcatcgtaatataggtttgtctttaacacgaccccctttaatgggataagacttcattattgttgatgcacaggt |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
14612517 |
tgatgcattggttatttcatcgtaatataggtttgtctttaacacgaccccctttaatgggatacgacttcattattgttgatgtacaggt |
14612607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 17 - 241
Target Start/End: Complemental strand, 14596353 - 14596129
Alignment:
| Q |
17 |
aaatgtgattgccattggggttgcgttttctagaacaatttatagtgcagttccacaatggagtaagtttataggaggagcattctttagtttttgggtt |
116 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||| |||||||| || ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14596353 |
aaatgtgattgccattgtggttgcattttctagaaccatttatagcgcgaatccacaatggagtaagtttataggaggagcattctttagcttttgggtt |
14596254 |
T |
 |
| Q |
117 |
cttgcacatttgtatccatttgcaaaaggattgatgggaaggagagggaagacacccaccattgtatatgtgtggtcaggtctcattgcaattacacttt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| | |||| |
|
|
| T |
14596253 |
cttgcacatttgtatccatttgcaaaaggattgatgggaaggagagggaagactcccaccattgtatttgtgtggtcaggtctcattgcaatcatccttt |
14596154 |
T |
 |
| Q |
217 |
ctttgctttggattgccattagccc |
241 |
Q |
| |
|
||||||||||| || |||||||||| |
|
|
| T |
14596153 |
ctttgctttgggtttccattagccc |
14596129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 129 - 208
Target Start/End: Original strand, 47920405 - 47920484
Alignment:
| Q |
129 |
tatccatttgcaaaaggattgatgggaaggagagggaagacacccaccattgtatatgtgtggtcaggtctcattgcaat |
208 |
Q |
| |
|
||||| ||||||||||| ||||||||||| ||||||| ||||||||||||||| | ||| ||||| ||||| || ||||| |
|
|
| T |
47920405 |
tatccttttgcaaaaggtttgatgggaagaagagggaggacacccaccattgtttttgtatggtcgggtctaatagcaat |
47920484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 129 - 208
Target Start/End: Complemental strand, 29916713 - 29916634
Alignment:
| Q |
129 |
tatccatttgcaaaaggattgatgggaaggagagggaagacacccaccattgtatatgtgtggtcaggtctcattgcaat |
208 |
Q |
| |
|
||||| ||||||||||| ||||||||||| ||||||| ||||||||||||||| | ||| ||||| ||||| || ||||| |
|
|
| T |
29916713 |
tatccttttgcaaaaggtttgatgggaagaagagggaggacacccaccattgtttttgtatggtcgggtctgatagcaat |
29916634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University