View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1247_high_14 (Length: 448)
Name: NF1247_high_14
Description: NF1247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1247_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 7 - 60
Target Start/End: Complemental strand, 8027882 - 8027829
Alignment:
| Q |
7 |
tctgtaacattcattattttgtccatatggagttgaggttttatgtattcaatt |
60 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||||||| ||||| |
|
|
| T |
8027882 |
tctgtaacattcattattttgtccatatgaagttgagtttttatgtatccaatt |
8027829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University