View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1247_high_29 (Length: 311)
Name: NF1247_high_29
Description: NF1247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1247_high_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 82 - 283
Target Start/End: Original strand, 9192444 - 9192645
Alignment:
| Q |
82 |
atcaaaccaaaactgcccttaattatcacacactaatacccccatactatagggttaaatttgacttttaaacaacctagaaaccatgcagtttctcaaa |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9192444 |
atcaaaccaaaactgcccttaattatcacacactaatacccccatactatagggttaaatttgacttttaagcaacctagaaaccatgcagtttctcaaa |
9192543 |
T |
|
| Q |
182 |
gagatgcaacattaaaactcaatgcctaaagggcatggcgttatgggttaaaataaggtaaaaaacagcatggagctaatactatggattttaatgctct |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9192544 |
gagatgcaacattaaaactcaatgcctaaagggcatggcgttatgggttaaaataaggtaaaaaacagcatggagctaatactatggattttaatgctct |
9192643 |
T |
|
| Q |
282 |
gt |
283 |
Q |
| |
|
|| |
|
|
| T |
9192644 |
gt |
9192645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University