View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1247_high_47 (Length: 251)
Name: NF1247_high_47
Description: NF1247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1247_high_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 18568870 - 18568641
Alignment:
| Q |
1 |
tttggtcattttgttggcttggaataatctctcatcattgttttttctcctttaatctaaataagtggtatctatagaaatctagttttctttcatatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18568870 |
tttggtcattttgttggcttggaataatctctcatcattgttttttctcctttaatctaaataagtggtatccatagaaatctagttttctttcatatta |
18568771 |
T |
|
| Q |
101 |
ttccgtgatttcatcgtttgattc--------atttgtttgtcttcttgtttcactccaatctatttcaaactcaatcaatgattcaggcatcaagatta |
192 |
Q |
| |
|
|| | ||||||||||||||||||| |||||||||||||||||| ||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18568770 |
tttcatgatttcatcgtttgattctgacattgttttgtttgtcttcttgttccactccaatatatttcaaactcaatcaataattcaggcatcaagatta |
18568671 |
T |
|
| Q |
193 |
ttgatgttgtggaaaatatacatgttgaaa |
222 |
Q |
| |
|
||||||||| |||||||||||||||||||| |
|
|
| T |
18568670 |
ttgatgttgcggaaaatatacatgttgaaa |
18568641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University