View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1247_high_53 (Length: 214)
Name: NF1247_high_53
Description: NF1247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1247_high_53 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 26 - 138
Target Start/End: Original strand, 43385213 - 43385325
Alignment:
| Q |
26 |
aaatcactaaactacaaaaccctaagaaaccaaatgcttccattctctgttgcttgtgtgacaagcattcatagctgcgccaacaatatcatttgcaatt |
125 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43385213 |
aaatcacaaaactacaaaaccctaagaaaccaaatgcttccattctctgttgcttgtgtgacaagcattcatagctgcgccaacaatatcatttgcaatt |
43385312 |
T |
|
| Q |
126 |
tatggcttgtgac |
138 |
Q |
| |
|
||||||||||||| |
|
|
| T |
43385313 |
tatggcttgtgac |
43385325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 164 - 208
Target Start/End: Original strand, 43385353 - 43385397
Alignment:
| Q |
164 |
tagcaattattagaaatgtgatgacatataaactatattattcga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
43385353 |
tagcaattattagaaatgtgatgacatataaactatttttttcga |
43385397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 75 - 112
Target Start/End: Original strand, 37355876 - 37355913
Alignment:
| Q |
75 |
ttgcttgtgtgacaagcattcatagctgcgccaacaat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37355876 |
ttgcttgtgtgacaagcattcatagctgcgctaacaat |
37355913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 105
Target Start/End: Original strand, 15757266 - 15757296
Alignment:
| Q |
75 |
ttgcttgtgtgacaagcattcatagctgcgc |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15757266 |
ttgcttgtgtgacaagcattcatagctgcgc |
15757296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University