View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1247_low_16 (Length: 448)

Name: NF1247_low_16
Description: NF1247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1247_low_16
NF1247_low_16
[»] chr7 (1 HSPs)
chr7 (7-60)||(8027829-8027882)


Alignment Details
Target: chr7 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 7 - 60
Target Start/End: Complemental strand, 8027882 - 8027829
Alignment:
7 tctgtaacattcattattttgtccatatggagttgaggttttatgtattcaatt 60  Q
    ||||||||||||||||||||||||||||| ||||||| |||||||||| |||||    
8027882 tctgtaacattcattattttgtccatatgaagttgagtttttatgtatccaatt 8027829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University