View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1247_low_25 (Length: 379)
Name: NF1247_low_25
Description: NF1247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1247_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 29 - 280
Target Start/End: Complemental strand, 34547463 - 34547212
Alignment:
| Q |
29 |
accacattgtttttgcacaacctcttttccctccaccatatcatctttttagcaattgttggctgtagtcaggtgcatgaagggaattagattcaattta |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34547463 |
accacattgtttttgcacaacctcttttccctccaccatatcttctttttagcaattgttggctgtagtcaggtgcatgaagggaattagattcaattta |
34547364 |
T |
|
| Q |
129 |
ttactatcactttgaataatattgagaataacgaatagcatatgccatatatatttgctgatataaatacatgcacggttgaggcagtaattaagcaagt |
228 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34547363 |
ttactatcactttaaataatattgagaataacgaatagcatatgccatatatatttgttgatataaatacatgcacggttgaggcagtaattaagcaagt |
34547264 |
T |
|
| Q |
229 |
gttatctaaaaacaaagaagaaagacatcatgttgagatccgaggactacct |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34547263 |
gttatctaaaaacaaagaagaaagacatcatgttgagatccgaggactacct |
34547212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 91 - 128
Target Start/End: Complemental strand, 8240926 - 8240889
Alignment:
| Q |
91 |
ctgtagtcaggtgcatgaagggaattagattcaattta |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8240926 |
ctgtagtcaggtgcatgaagggaattagtttcaattta |
8240889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 84 - 128
Target Start/End: Original strand, 8240955 - 8240999
Alignment:
| Q |
84 |
ttgttggctgtagtcaggtgcatgaagggaattagattcaattta |
128 |
Q |
| |
|
||||| |||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
8240955 |
ttgttagctgaagtcaggtgcatcaagggaattagattcaattta |
8240999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University