View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1247_low_36 (Length: 311)

Name: NF1247_low_36
Description: NF1247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1247_low_36
NF1247_low_36
[»] chr5 (1 HSPs)
chr5 (82-283)||(9192444-9192645)


Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 82 - 283
Target Start/End: Original strand, 9192444 - 9192645
Alignment:
82 atcaaaccaaaactgcccttaattatcacacactaatacccccatactatagggttaaatttgacttttaaacaacctagaaaccatgcagtttctcaaa 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
9192444 atcaaaccaaaactgcccttaattatcacacactaatacccccatactatagggttaaatttgacttttaagcaacctagaaaccatgcagtttctcaaa 9192543  T
182 gagatgcaacattaaaactcaatgcctaaagggcatggcgttatgggttaaaataaggtaaaaaacagcatggagctaatactatggattttaatgctct 281  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9192544 gagatgcaacattaaaactcaatgcctaaagggcatggcgttatgggttaaaataaggtaaaaaacagcatggagctaatactatggattttaatgctct 9192643  T
282 gt 283  Q
    ||    
9192644 gt 9192645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University