View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1247_low_48 (Length: 269)
Name: NF1247_low_48
Description: NF1247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1247_low_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 48 - 239
Target Start/End: Complemental strand, 16976075 - 16975882
Alignment:
| Q |
48 |
aaaagatgcattgatataaatata--aagtagaggaagaaaagcacatggagtatccgttttttgcgccgggtatatg-atatgagataaaataattgag |
144 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16976075 |
aaaagatgcattgatataaatatataaagtagaggaagaaaagcacatggagtatccgtttgttgcgccgggtatatgtatatgagataaaataattgag |
16975976 |
T |
 |
| Q |
145 |
gatttaacattgcttcataagaccaacaccattaatataatatatgttttttcatacatattttgtttcatactatgcatgaatattgtactagt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16975975 |
gatttaacattgcttcataagaccaacaccattaat-taatatatgttttttcatacatattttgtttcatactatgcatgaatattgtactagt |
16975882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University