View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1247_low_61 (Length: 245)
Name: NF1247_low_61
Description: NF1247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1247_low_61 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 67 - 162
Target Start/End: Complemental strand, 42452912 - 42452817
Alignment:
| Q |
67 |
tgaacatcaacaggttgagatgtagaagttatcacttcttcgattctgagaactttaacaggatgagatggaagagtcattccttatttatctctg |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
42452912 |
tgaacatcaacaggttgagatgtagaagttatcacttcttcaattctgagaactttaacaggatgagatggaagagtcattccttgttcatctctg |
42452817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 67 - 161
Target Start/End: Complemental strand, 41594483 - 41594389
Alignment:
| Q |
67 |
tgaacatcaacaggttgagatgtagaagttatcacttcttcgattctgagaactttaacaggatgagatggaagagtcattccttatttatctct |
161 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||| ||||| ||||||||| ||| ||||||||| |||||||||||| || |||||| |
|
|
| T |
41594483 |
tgaacatcaacaggttgagtcatatgagttatgtcttcttcaattcttggaactttaataggttgagatggaggagtcattccttgttcatctct |
41594389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 68 - 161
Target Start/End: Original strand, 23123458 - 23123551
Alignment:
| Q |
68 |
gaacatcaacaggttgagatgtagaagttatcacttcttcgattctgagaactttaacaggatgagatggaagagtcattccttatttatctct |
161 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||| || |||||||||||| ||||||||| |||||||||||| || |||||| |
|
|
| T |
23123458 |
gaacatcaataggttgagatgtagaagttatcacttcttcaattatggaaactttaacaggttgagatggaggagtcattccttgttcatctct |
23123551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 67 - 161
Target Start/End: Complemental strand, 14007344 - 14007250
Alignment:
| Q |
67 |
tgaacatcaacaggttgagatgtagaagttatcacttcttcgattctgagaactttaacaggatgagatggaagagtcattccttatttatctct |
161 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||| ||||| ||||||||| ||| ||||||||| |||||||||||| || |||||| |
|
|
| T |
14007344 |
tgaacatcaacaggttgagtcatatgagttatgtcttcttcaattcttggaactttaataggttgagatggaggagtcattccttgttcatctct |
14007250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 67 - 161
Target Start/End: Complemental strand, 43523090 - 43522996
Alignment:
| Q |
67 |
tgaacatcaacaggttgagatgtagaagttatcacttcttcgattctgagaactttaacaggatgagatggaagagtcattccttatttatctct |
161 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||| ||||| ||||||||| ||| ||||||||| |||||||||||| || |||||| |
|
|
| T |
43523090 |
tgaacatcaacaggttgagtcatatgagttatgtcttcttcaattcttggaactttaataggttgagatggaggagtcattccttgttcatctct |
43522996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 68 - 161
Target Start/End: Original strand, 22511998 - 22512091
Alignment:
| Q |
68 |
gaacatcaacaggttgagatgtagaagttatcacttcttcgattctgagaactttaacaggatgagatggaagagtcattccttatttatctct |
161 |
Q |
| |
|
|||||||||||||||||| || |||||| ||||||| |||| ||||||||||||| ||||||||| |||||||||||| || |||||| |
|
|
| T |
22511998 |
gaacatcaacaggttgagtcatatgagttatgtcttcttcaattcatggaactttaacaggttgagatggaggagtcattccttgttcatctct |
22512091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 67 - 161
Target Start/End: Original strand, 12869292 - 12869386
Alignment:
| Q |
67 |
tgaacatcaacaggttgagatgtagaagttatcacttcttcgattctgagaactttaacaggatgagatggaagagtcattccttatttatctct |
161 |
Q |
| |
|
||||||||||||||||||| || |||||| ||||||| ||||| |||||||| ||| ||||||||| |||||||||||| || |||||| |
|
|
| T |
12869292 |
tgaacatcaacaggttgagtcatatgagttatgtcttcttcaattcttgaaactttaataggttgagatggaggagtcattccttgttcatctct |
12869386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University