View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1247_low_62 (Length: 245)
Name: NF1247_low_62
Description: NF1247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1247_low_62 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 95 - 245
Target Start/End: Original strand, 33384887 - 33385037
Alignment:
| Q |
95 |
attttcccattgtatgcagctggattattgacttcatttctgttgaagttgaaaaatgatggatttcaacatgattcatcttgggagaacatgaaatctt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33384887 |
attttcccattgtatgcagctggattattgacttcatttctgttgaagttgaaaaatgatggatttcaacatgattcatcttgggagaacatgaaatctt |
33384986 |
T |
 |
| Q |
195 |
atggcggttttgtactggatggctttcttttgccacaagtaattctaaact |
245 |
Q |
| |
|
|||||||||| ||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33384987 |
atggcggtttggtattggatggctttcttgtgccacaagtaattctaaact |
33385037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 161 - 245
Target Start/End: Original strand, 33378845 - 33378929
Alignment:
| Q |
161 |
caacatgattcatcttgggagaacatgaaatcttatggcggttttgtactggatggctttcttttgccacaagtaattctaaact |
245 |
Q |
| |
|
||||||||| | |||||||||| ||| ||||||||||| ||||| ||| ||||| |||||||| |||||||||| |||||||||| |
|
|
| T |
33378845 |
caacatgatccgtcttgggagagcataaaatcttatggtggtttggtattggattgctttcttgtgccacaagtcattctaaact |
33378929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University