View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1247_low_65 (Length: 234)
Name: NF1247_low_65
Description: NF1247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1247_low_65 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 80 - 234
Target Start/End: Complemental strand, 15264952 - 15264798
Alignment:
| Q |
80 |
caaaggggttcagataggaagaaacaggtccatagtgttggcactgtctaataaatgcgaatgacattgagaattaaacataatgtatcaatgtgtatga |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
15264952 |
caaaggggttcagataggaagaaacaggtccatagtgttggcactgtctaataaatgcgaatgacattgagaattaaacataatgtagcaatgtgtatga |
15264853 |
T |
 |
| Q |
180 |
gtagttttactcagtagcaacttgaaccaattgctataaatgcacctctgttgtt |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15264852 |
gtagttttactcagtagcaacttgaaccaattgctataaatgcacctctgttgtt |
15264798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University