View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1247_low_65 (Length: 234)

Name: NF1247_low_65
Description: NF1247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1247_low_65
NF1247_low_65
[»] chr8 (1 HSPs)
chr8 (80-234)||(15264798-15264952)


Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 80 - 234
Target Start/End: Complemental strand, 15264952 - 15264798
Alignment:
80 caaaggggttcagataggaagaaacaggtccatagtgttggcactgtctaataaatgcgaatgacattgagaattaaacataatgtatcaatgtgtatga 179  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
15264952 caaaggggttcagataggaagaaacaggtccatagtgttggcactgtctaataaatgcgaatgacattgagaattaaacataatgtagcaatgtgtatga 15264853  T
180 gtagttttactcagtagcaacttgaaccaattgctataaatgcacctctgttgtt 234  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15264852 gtagttttactcagtagcaacttgaaccaattgctataaatgcacctctgttgtt 15264798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University