View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1247_low_68 (Length: 207)
Name: NF1247_low_68
Description: NF1247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1247_low_68 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 36 - 196
Target Start/End: Original strand, 46757619 - 46757779
Alignment:
| Q |
36 |
attgattatcttttatgggatttgcggcatttgagagagtaatttagtaagaagtaagatatagagtaacacaccttaatttgtgtactgctttttggga |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46757619 |
attgattatcttttatgggatttgcggcatttgagagagtaatttagtaagaagtaagatagagagtaacacaccttaatttgtgtactgctttttggga |
46757718 |
T |
 |
| Q |
136 |
tcttctcatcccaattccctaaagtaggggagagagcctctaatttatatggtgtattttg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46757719 |
tcttctcatcccaattccctaaagtaggggagagagcctctaatttatatggtgtattttg |
46757779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University