View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12480_low_7 (Length: 294)
Name: NF12480_low_7
Description: NF12480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12480_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 17 - 191
Target Start/End: Complemental strand, 38422977 - 38422803
Alignment:
| Q |
17 |
actttgcctgtttcattcatggaagatgttgtttttaaggttgtctctgcctttgaggctgttgttcttgttctcaccctctgcttcttttacctttgtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38422977 |
actttgcctgtttcattcatggaagatgttgtttttaaggttgtctctgcctttgaggctgttgttcttgttctcaccctctgcttcttttacctttgtt |
38422878 |
T |
|
| Q |
117 |
gtggttgcagcttctgatttatctacaatttgtaccatttttctaacttcctcctattcaatgcaatcacaggtt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38422877 |
gtggttgcagcttctgatttatctacaatttgtaccatttttctaacttcctcctattcaatgcaatcacaggtt |
38422803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 17 - 136
Target Start/End: Complemental strand, 38413090 - 38412971
Alignment:
| Q |
17 |
actttgcctgtttcattcatggaagatgttgtttttaaggttgtctctgcctttgaggctgttgttcttgttctcaccctctgcttcttttacctttgtt |
116 |
Q |
| |
|
|||| ||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38413090 |
acttcgccggtttcattcatggaagatattgtttttaaggttgtctctgcctttgaggctgttgttcttgttctcaccctctgcttcttttacctttgtt |
38412991 |
T |
|
| Q |
117 |
gtggttgcagcttctgattt |
136 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
38412990 |
gtggttgcagcttctgattt |
38412971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University