View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12480_low_9 (Length: 233)
Name: NF12480_low_9
Description: NF12480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12480_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 18 - 218
Target Start/End: Original strand, 31817721 - 31817911
Alignment:
| Q |
18 |
atatcccacttgatccaatggtgcatagtacaacacatatatcaattgtgcaccatataactagcatatgtttttaacatctaaagatagatgatatgaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31817721 |
atatcccacttgatccaatggtgcatagtacaacacatatatcaattgtgcaccatat-----------gtttttaacatctaaagatagatgatatgaa |
31817809 |
T |
|
| Q |
118 |
tcaaaa-acaaatataatttaatcataaaaattggcggtgttaattaccttgtatagatccaagagaatattatcaagggattcttgtgcttgatctgag |
216 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31817810 |
tcaaaaaacaaatataatttaatcataaaaattggcggtgttaattaccttgtatagatccaagagaatattatcaagggattcttgtgcttgatctgag |
31817909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University