View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12483_high_2 (Length: 324)
Name: NF12483_high_2
Description: NF12483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12483_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 21 - 317
Target Start/End: Original strand, 33759300 - 33759595
Alignment:
| Q |
21 |
attcatcatttttgtttctcataaaaatatgatctgatttgtttgtatcaaatcatttaattatatttcactatgaagatgccttttttgttattatcat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| ||||||||||||||||||| |
|
|
| T |
33759300 |
attcatcatttttgtttctcataaaaatatgatctgatttgtttgtatcaaatcatttaattatatttcactgtgatgat-ccttttttgttattatcat |
33759398 |
T |
 |
| Q |
121 |
attagtagtttgattctatcttcaatatgtggtcgaactcgaatgtttgattcagatctcatgcttatgatcaaattcactatttgaaaaaggcaattca |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33759399 |
attagtagtttgattctatcttcaatatgtggtcgaactcgaatgtttgattcagatctcatgcttatgatcaaattcactatttgaaaaaggcaattca |
33759498 |
T |
 |
| Q |
221 |
tagatgcatttcaggtcatcggaagaaaatagtctttagagttgaacatagatattatgtggtaatttgataatcactctgctggtaatctctgctt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33759499 |
tagatgcatttcaggtcatcggaagaaaatagtctttagagttgaacatagatattatgtggtaatttgataatcactctgctggtaatctctgctt |
33759595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University