View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12483_low_5 (Length: 301)
Name: NF12483_low_5
Description: NF12483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12483_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 14 - 291
Target Start/End: Original strand, 32239965 - 32240241
Alignment:
| Q |
14 |
atagctaggtgctacttctgtgtgctatattatggtgaaagtaatgggttagagatgtaggctttttgtattctaatgtgatctattaatcttacaatag |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32239965 |
atagctaggtgctacttctgtgtgctatattatggtgaaagtaatgggttagagatgcaggctttttgtattctaatgtgatctattaatcttacaatag |
32240064 |
T |
 |
| Q |
114 |
aacctcttcaaatccaactgttccatacactaccagcgggatccgcccttcttcgcttctgctgctactctctgtgggttttctggtttctgaggatatg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32240065 |
aacctcttcaaatccaactgttccatacactaccagcgggatccgcccttcttcgcttctgctgctgctctctgtgggttttctggtttctgaggatatg |
32240164 |
T |
 |
| Q |
214 |
tagctgggtgctacgcctgttcctttttactttcnnnnnnnnnngtgtgtggtttataggcttctacggtgctctctg |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
32240165 |
tagctgggtgctacgcctgttcctttttactttc-tttttttttgtgtgtggtttataggcttctgcggtgctctctg |
32240241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University