View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12483_low_6 (Length: 297)
Name: NF12483_low_6
Description: NF12483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12483_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 17 - 156
Target Start/End: Complemental strand, 38773145 - 38773011
Alignment:
| Q |
17 |
aattgtttcaatgtttagtcgcaaggattttgaacttttacttaaatattttgacttcatatgtcattgaagttttgaacggttttcaagtatcgatcaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38773145 |
aattgtttcaatgtttagtcgcaaggattttgaacttttacttaaatattttgacttcatatgtcattgaagttttgaacgattttcaagtatcgatcaa |
38773046 |
T |
 |
| Q |
117 |
ccataccatataccatataaaacacttccctactgtagcg |
156 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38773045 |
c-----catataccatataaaacacttccctactgtagcg |
38773011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 220 - 284
Target Start/End: Complemental strand, 38772946 - 38772878
Alignment:
| Q |
220 |
gtaagtgtggacggacactggacagc----atttcgtttcataatcctacaaaaagtagtaacaaagca |
284 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38772946 |
gtaagtgtggacggacactggacagctagcatttcgtttcataatcctacaaaaagtagtaacaaagca |
38772878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University